|
Thermo Fisher
gene exp ank2 mm00618325 m1 Gene Exp Ank2 Mm00618325 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Gene+Exp%2E+Ank2%2C+Mm00618325_m1/bio_rxiv__2025__08__08__669189-120-19--1 Average 87 stars, based on 1 article reviews
gene exp ank2 mm00618325 m1 - by Bioz Stars,
2026-09
87/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
ank2 ![]() Ank2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Ankyrin+B+Antibody/pmc12316014-65-18-19 Average 93 stars, based on 1 article reviews
ank2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
ggttcctgagtcgtatcgcgta ![]() Ggttcctgagtcgtatcgcgta, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Ankyrin+brain+(ANK2)+Human+qPCR+Primer+Pair/pm40359940-212-110-111 Average 93 stars, based on 1 article reviews
ggttcctgagtcgtatcgcgta - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
primer: qpcr for ank2 reverse ![]() Primer: Qpcr For Ank2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/primer++qpcr+for+ank2+reverse/pm40359940-214-106-111 Average 90 stars, based on 1 article reviews
primer: qpcr for ank2 reverse - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
primer: qpcr for ank2 forward ![]() Primer: Qpcr For Ank2 Forward, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/primer++qpcr+for+ank2+reverse/pm40359940-214-97-102 Average 90 stars, based on 1 article reviews
primer: qpcr for ank2 forward - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Empire Genomics
fish probe-ank2 rp11-730e1 ![]() Fish Probe Ank2 Rp11 730e1, supplied by Empire Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/human+bac+clone+rp11+1023e23/pm40359940-241-10-15 Average 90 stars, based on 1 article reviews
fish probe-ank2 rp11-730e1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
mouse anti ank2 ![]() Mouse Anti Ank2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/Ankyrin+B+Antibody/bio_rxiv__2025__04__01__646704-181-11-13 Average 93 stars, based on 1 article reviews
mouse anti ank2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
mouse ank2 exon 24 flox b6 129 cg ank2tm1 1 pmoh mnrj ![]() Mouse Ank2 Exon 24 Flox B6 129 Cg Ank2tm1 1 Pmoh Mnrj, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/129+b6/pmc11097922-964-0-10 Average 86 stars, based on 1 article reviews
mouse ank2 exon 24 flox b6 129 cg ank2tm1 1 pmoh mnrj - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Wolters Kluwer Health
ank2 expression ![]() Ank2 Expression, supplied by Wolters Kluwer Health, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ank2/ank2+expression/10__1097_slash_cji__0000000000000554-137-38-53 Average 86 stars, based on 1 article reviews
ank2 expression - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
Journal: Brain
Article Title: Combined genomics and proteomics unveils elusive variants and vast aetiologic heterogeneity in dystonia
doi: 10.1093/brain/awaf059
Figure Lengend Snippet: Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , ANK2 , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Article Snippet: Total protein lysates processed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis were probed with the following primary antibodies:
Techniques: Diagnostic Assay, Sequencing, Comparison, Western Blot, Expressing, Standard Deviation, Variant Assay, Isolation